Skip to main content

Advertisement

Table 1 The polymerase chain reaction (PCR) primers and homogeneous Mass EXTEND (hME) primers of 22 single nucleotide polymorphisms (SNPs) in three candidate genes

From: Polymorphisms of MTHFR and TYMS predict capecitabine-induced hand-foot syndrome in patients with metastatic breast cancer

Gene Localization SNP PCR primer (5′ → 3′) hME primer (5′ → 3′)
TYMS 18p11.32 2790 First: ACGTTGGATGGGATGCCGAGGTAAAAGTTC GATTTTTGACCTAGTTCCTT
Second: ACGTTGGATGAACTGATAGGTCACGGACAG  
2,853,741 First: ACGTTGGATGGGAAACAGATCTCAAACAGC GGTACCACGTTTTCCTGCGGTCTTGTC
Second: ACGTTGGATGAGCACAGTTCCCACGTTTTC  
2,606,241 First: ACGTTGGATGCCACAGCTGAGAGTCTTAGG GGGCGCAGTCCTTCCC
Second: ACGTTGGATGACCAGACGGTTCCCAAAGG  
3,786,362 First: ACGTTGGATGTTGGACAGCCTGGGATTCTC GCCCAAGTCCCCTTC
Second: ACGTTGGATGCAAAATGCCTCCACTGGAAG  
1,004,474 First: ACGTTGGATGTAAAACTGTGACTCTCCCCC GACCTCAGATGGTGATGTTCGTCTA
Second: ACGTTGGATGGGGAAAGGCTGACATACATC  
9,947,507 First: ACGTTGGATGAATTCTTCTGCCTCAGCCTC GCCCCCGTCTCTACTAAAA
Second: ACGTTGGATGTGGACAACATGGTGAAACCC  
699,517 First: ACGTTGGATGCCACTGAAGAACCCTAAAAG GGAGAAAGACTGACAATATCCTTC
Second: ACGTTGGATGACTTTTACCTCGGCATCCAG  
9,967,368 First: ACGTTGGATGTGGGTGACAGAGCCGTATG AACCCAGATATTCCTTTCTATT
Second: ACGTTGGATGGAATCCATGGTCTCCACAAC  
15,872 First: ACGTTGGATGACAGAACTACACTACCAAGG CCCCCCTCTCATGGTCACTGTTCC
Second: ACGTTGGATGGAAAGTCCTCTCATGGTCAC  
MTHFR 1p36.3 1,801,133 First: ACGTTGGATGCTTGAAGGAGAAGGTGTCTG AACGCGTGATGATGAAATCG
Second: ACGTTGGATGTGCATGCCTTCACAAAGCGG  
1,801,131 First: ACGTTGGATGTCTCCCGAGAGGTAAAGAAC CATGAGCTGACCAGTGAAG
Second: ACGTTGGATGAGGAGCTGCTGAAGATGTGG  
3,737,964 First: ACGTTGGATGTGATGGCTGTAGATCCTCAC GCAGCCCTCAAAAAAAACCTTTC
Second: ACGTTGGATGTCAAATAGGAACCAGCCCTC  
4,846,049 First: ACGTTGGATGAACTAAGCCCTCGAACCAAG TGCACGGGCTCCAAG
Second: ACGTTGGATGTGTTTTGCCTGTACTGCACG  
2,274,976 First: ACGTTGGATGTATGTGTGTGTAGGACGAGG CATACAGCTTTCCCCAC
Second: ACGTTGGATGATGTACTGGATGATGGTGCG  
3,753,582 First: ACGTTGGATGACGCAGTGGGCGCCAGGGA CTCATTTTAAACCTGCCTCCCCGGCGA
Second: ACGTTGGATGTGCCTTTTAAACCTGCCTCC  
4,846,048 First: ACGTTGGATGTTTGGTTTGGTGGTGGCTTC GGAATCAGTTAGTTCTGACACCAACAA
Second: ACGTTGGATGTCCAGACCAGAAGCAGTTAG  
RRM1 11p15.5 725,519 First: ACGTTGGATGCACTTTAACTCTAGAAGATTG TGGTGAAGAAATATGTAATGCCTCA
Second: ACGTTGGATGGCCTAGCATATAAAGTGCTC  
720,106 First: ACGTTGGATGGCAGTAATAAGAGCAGTTATC AAACATTTATAACAAACTTAACATAC
Second: ACGTTGGATGAAGGGTCAAATGAGTACCTC  
1,042,858 First: ACGTTGGATGAGGGTTTGAAGACTGGGATG GAACTGGATTGGATTAGC
Second: ACGTTGGATGGCTTCTCCTTATTTAGAGTG  
1,042,927 First: ACGTTGGATGCCACCAGTCAAAGCAGTAAA GGTAAGTAAGGTTTCATCACCC
Second: ACGTTGGATGCAGGGAGTGGTTAAGTAAGG  
11,030,918 First: ACGTTGGATGTCCTGACGCAAATCAGAGCC GGCTTACCCTGCCCTGCTTAAAAT
Second: ACGTTGGATGCCACTGAAGAACCCTAAAAG  
1,980,412 First: ACGTTGGATGGGTCTTCAGAACTATGAGAG GGGCCAAAGGTATTTAAGTTTCCTATG
Second: ACGTTGGATGCCAGAGGACAAAGGTATTTA  
  1. TYMS thymidylate synthase, MTHFR methylene tetrahydrofolate reductase, RRM1 ribonucleotide reductase M1