Skip to main content

Advertisement

Table 3 Primer sequences used for real-time RT-PCR

From: Protein-coding genes combined with long noncoding RNA as a novel transcriptome molecular staging model to predict the survival of patients with esophageal squamous cell carcinoma

Gene Forward (5′–3′) Reverse (5′–3′)
SEMA3A TGGTTCTGCATGTTCTCGCT CTCTCTGCGACTTCGGACTG
BEX2 TCGAGAATCGGGAGGAGGAGAC TCCTGGTTGACATTTTCCACGAT
LINC01800 CCACACTGGAGTGCAGCTAT CCACCTGTCTGATGGTCTTCT
Β-actin AGCGAGCATCCCCCAAAGTT GGGCACGAAGGCTCATCATT
  1. RT-PCR Reverse transcription polymerase chain reaction