Skip to main content

Table 1 Primers and reaction conditions for the measurement of gene transcriptional levels using quantitative reverse transcription-polymerase chain reaction

From: Follistatin-like protein 1 plays a tumor suppressor role in clear-cell renal cell carcinoma

Gene Reaction program Forward primer (5′–3′) Reverse primer (5′–3′) E (%) R 2 Location
FSTL1 95 °C for 3 min; 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 25 s AAATGCAGCTCCCTGTCCAA ACTCTTGCCCTCCTCCCATAG 95.5 0.999 Transcript: NM_007085.4
Forward primer: exon 11
Reverse primer: exon 11
IL-6 95 °C for 10 min; 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 25 s GCTTTAAGGAGTTCCTGC GGTAAGCCTACACTTTCCA 102.6 0.997 Transcript: NM_000600.4
Forward primer: exon 5
Reverse primer: exon 5
N-cadherin 95 °C for 3 min; 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 25 s TGGATGAAGATGGCATGG AGGTGGCCACTGTGCTTAC 98.6 0.999 Transcript: NM_001792.4
Forward primer: exon 3
Reverse primer: exon 4
E-cadherin 95 °C for 4 min; 40 cycles of 95 °C for 10 s and 60 °C for 45 s GTCATCCAACGGGAATGCA TGATCGGTTACCGTGATCAAAA 97.1 0.999 Transcript: NM_004360.4
Forward primer: exon 4
Reverse primer: exon 5
GAPDH 95 °C for 10 min; 45 cycles of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 25 s TGACTTCAACAGCGACACCCA CACCCTGTTGCTGTAGCCAAA 101.5 0.998 Transcript: NM_002046.5
Forward primer: exon 6
Reverse primer: exon 4
  1. E = primer efficiency; R2 = correlation coefficient
  2. FSTL1 follistatin-like protein 1; IL-6 interleukin-6; GAPDH glyceraldehyde-3-phosphate dehydrogenase