Skip to main content

Table 3 Primers for polymerase chain reaction (PCR) amplification and subsequent P53 sequencing reactions

From: Why some tumours trigger neovascularisation and others don’t: the story thus far

Primer Sequence Annealing temperature (°C) Amplicon length (bp)
Exon 3–4 Forward: GTGGGAAGCGAAAATTCCAT
Reverse: GCCAGGCATTGAAGTCTCAT
60 506
Exon 5–6 Forward: TGTTCACTTGTGCCCTGACT
Reverse: TTAACCCCTCCTCCCAGAGA
60 467
Exon 7 Forward: GAGCTTGCAGTGAGCTGAGA
Reverse: GGGATGTGATGAGAGGTGGA
EX7F_seq CCTGCTTGCCACAGGTCT (to be used for sequencing instead of Exon 7 forward primer)
61.5 390
Exon 8–9 Forward: GACAAGGGTGGTTGGGAGTA
Reverse: GCCCCAATTGCAGGTAAAAC
60 500