Skip to main content

Advertisement

Table 2 Primers used in the nested polymerase chain reaction (PCR) and their sequences

From: A single nucleotide polymorphism in the Epstein-Barr virus genome is strongly associated with a high risk of nasopharyngeal carcinoma

Primer EBV locusa Sequences (5′ → 3′) Note
EBNA1-1 96,750–67 GGGAAGTCGTGAAAGAGC Outer primer
EBNA1-2 97,479–96 GGTGGAAACCAGGGAGGC
EBNA1-3 97,052–72 GGTTTGGAAAGCATCGTGGTC Inner primer
EBNA1-4 97,390–410 AACAAGGTCCTTAATCGCATC
LMP1-CT-1 167,623–42 GCTAAGGCATTCCCAGTAAA Outer primer
LMP1-CT-2 168,268–86 GATGAACACCACCACGATG
LMP1-CT-3 167,755–72 CGGAACCAGAAGAACCCA Inner primer
LMP1-CT-4 168,244–61 TCCCGCACCCTCAACAAG
RPMS1-1 155,087–107 GCTGGGTTGATGCTGTAGATG 1st round nested
RPMS1-2 155,799–819 AGGGTCTGGACGTGGAGTTTG
RPMS1-3 155,103–121 AGATGTGCCTGGCTCTGTC 2nd round nested
RPMS1-4 155,543–63 CAATGACTTTGTCACCTTTGG
RPMS1-5 155,199–220 AGAAGGCGTAGAGCATGTCCAG 3rd round nested
RPMS1-6 155,460–81 GAGTACGACTGTGAGGTGGGCG
  1. EBV Epstein-Barr virus, EBNA1 EBV nuclear antigen 1, LMP1 latent membrane protein 1
  2. aCoordinates relative to complete wild-type EBV genome (GenBank Accession No. NC_007605)