Skip to main content


Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 2 Primers used in the nested polymerase chain reaction (PCR) and their sequences

From: A single nucleotide polymorphism in the Epstein-Barr virus genome is strongly associated with a high risk of nasopharyngeal carcinoma

Primer EBV locusa Sequences (5′ → 3′) Note
EBNA1-1 96,750–67 GGGAAGTCGTGAAAGAGC Outer primer
EBNA1-3 97,052–72 GGTTTGGAAAGCATCGTGGTC Inner primer
LMP1-CT-1 167,623–42 GCTAAGGCATTCCCAGTAAA Outer primer
LMP1-CT-3 167,755–72 CGGAACCAGAAGAACCCA Inner primer
RPMS1-1 155,087–107 GCTGGGTTGATGCTGTAGATG 1st round nested
RPMS1-3 155,103–121 AGATGTGCCTGGCTCTGTC 2nd round nested
RPMS1-5 155,199–220 AGAAGGCGTAGAGCATGTCCAG 3rd round nested
  1. EBV Epstein-Barr virus, EBNA1 EBV nuclear antigen 1, LMP1 latent membrane protein 1
  2. aCoordinates relative to complete wild-type EBV genome (GenBank Accession No. NC_007605)