Skip to main content

Advertisement

Table 1 Primer sequences used in this study

From: Cytochrome b5 reductase 2 suppresses tumor formation in nasopharyngeal carcinoma by attenuating angiogenesis

Primer Primer sequence (5′–3′) Product size (bp)
CYB5R2 Forward: AAACACTGGCCGATCACCT 150
Reverse: TGACCAAGATATCCTCCTCTGT
FAS Forward: CTGCCATAAGCCCTGTCCTCCA 199
Reverse: ATTCTGGGTCCGGGTGCAGTT
FOS Forward: TGGCAGGAGGGGCAAGGTGGA 240
Reverse: GCAGGTCGGTGAGCTGCCAGGATG
PIK3R1 Forward: CGGCAAAAGAAGTTGAACGAGTGG 347
Reverse: TGCACAAGGGAGGTGTGTTGGTAA
ITGB3 Forward: GTAACCTGCGGATTGGCTTCG 170
Reverse: GAAGCGGGTCACCTGGTCAGT
MTSS1 Forward: GTGGTGGGACCAGGGAGATTG 232
Reverse: TTCAGCGTATCCGAGGACTTCTT
ITGB5 Forward: CCGGCTCGCAGGTCTCAAC 306
Reverse: TCACCGGGCCGGAGGTTCAC
IFNB1 Forward: GCTCTCCTGTTGTGCTTCTCCACT 176
Reverse: AGCTGCTTAATCTCCTCAGGGATG
VEGF Forward: CTTCTGAGTTGCCCAGGAGACCACT 230
Reverse: TCAACCACTCACACACACACAACCA
IGF1 Forward: CAACAAGCCCACAGGGTATGGCT 173
Reverse: TGGGCATGTCGGTGTGGCGCT
TEK Forward: CAGGAGTTTGGGTCTGCAGTGTGA 383
Reverse: TGGAGGAGGGAGTCCGATAGAAGC
TGFBR1 Forward: GCATTGGCAAAGGTCGATTTGG 303
Reverse: TCGCCGTGGACAGAGCAAGTT
CDKN2A Forward: CGAAGGTCCTACAGGGCCACAAC 273
Reverse: CTCGCAAGAAATGCCCACATGAA
GAPDH Forward: AAGCTCACTGGCATGGCCTT 375
Reverse: CTCTCTTCCTCTTGTGCTCTTG
HIF-1α Forward: CCGAATTGATGGGATATGAG 150
Reverse: TCATGATGAGTTTTGGTCAGATG
  1. CYB5R2 cytochrome b5 reductase 2, FAS Fas cell surface death receptor, FOS FBJ murine osteosarcoma viral oncogene homolog, PIK3R1 phosphoinositide-3-kinase regulatory subunit 1, ITGB3 integrin beta 3, MTSS1 metastasis suppressor 1, ITGB5 integrin beta 5, IFNB1 interferon beta 1, VEGF vascular endothelial growth factor, IGF1 insulin-like growth factor 1, TEK TEK tyrosine kinase, TGFBR1 transforming growth factor beta receptor 1, CDKN2A cyclin-dependent kinase inhibitor 2A, GAPDH glyceraldehyde-3-phosphate dehydrogenase, HIF-1α hypoxia-induced factor-1 alpha.